bbsi restriction enzyme (New England Biolabs)

New England Biolabs is a verified supplier

New England Biolabs manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

New England Biolabs bbsi restriction enzyme
Bbsi Restriction Enzyme, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1960 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/restriction+enzyme+bbsi/BbsI/pm41727907-146-19-22
Average 99 stars, based on 1960 article reviews

bbsi restriction enzyme - by Bioz Stars, 2026-10

99/100 stars

Images

Plasmid Preparation:

Article Title: A fluorescent perilipin 2 knock-in mouse model reveals a high abundance of lipid droplets in the developing and adult brain
Article Snippet: .. The sgRNA plasmid backbone, pSpCas9 (BB)−2A-Puro (PX459) v2.0 (Ran et al., 2013), was digested for 4 h at 37 °C using the restriction enzyme BbsI (#R3539S, New England Biolabs) and run on a 1% agarose gel for 3.5 h at 100 V. The digested band was cut out and extracted from the gel using QIAquick Gel Extraction Kit (#28704, Qiagen). .. The sgRNA was then ligated into the backbone by incubation of 10 ng backbone, annealed and phosphorylated sgRNA (1:10) and T4 Ligase reaction buffer (1:10, #B0202S, New England Biolabs) with 10 mM 10x Adenosine 5’-Triphosphate (#P0756S, New England Biolabs) for 30 min in RT. sgRNA oligonucleotide: 5’ CACCGTCCTGGAGAAAAGAGACGCC 3’ tdTomato plasmid: Mouse Plin2 homology arms were obtained by extracting DNA from mouse primary mouse NSPCs from the SVZ using DNeasy Blood & Tissue Kit (#69506, Qiagen).

Article Title: A 20-amino-acid Cardiovirus protein exhibits cytokine-mimicry activity to regulate viral replication.
Article Snippet: CRISPR-Cas9 knockout cell line generation Backbone plasmid spCas9(BB)-2A-GFP (PX458) was a gift from Feng Zhang (Addgene plasmid #48138; http://n2t.net/addgene: 48138; RRID:Addgene 48138), generated according to this published protocol. .. 38 The plasmid was digested using restriction enzyme BbsI (New England Biolabs, R0529S), then the digested plasmid was extracted using Monarch DNA Gel Extraction Kit (New England Biolabs, T1020). .. Forward and reverse oligomers were annealed and phosphorylated (using T4PNK, TOYOBO, PNK-111) to target the specific gene (Program: 37 ◦ C for 30min for phosphorylation, 95 ◦ C for 5min, ramped down 5 ◦ C/min to 25 ◦ C for annealing).

Article Title: From GWAS signal to function: targeted CRISPR activation enables functional characterization of non-coding SNPs in chickens
Article Snippet: .. The vector was digested with the restriction enzyme BbsI (New England Biolabs, Ipswich, MA, United States), and gRNAs targeting each region, as well as the mock control, were inserted by ligation ( ). ..

Article Title: Novel ADPRS Missense Variant (p.Leu162Pro) Causes Stress-Induced Childhood-Onset Neurodegeneration With Ataxia and Seizures
Article Snippet: .. These oligonucleotides were annealed and inserted into eSpCas9(1.1) vector (addgene #71814) using restriction enzyme BbsI and T4 DNA ligase from NEB (MA). .. Competent Escherichia coli cells (NEB® 5-alpha strain, MA) were transformed by heat shock and cloned vectors were purified by the Monarch® Plasmid Miniprep Kit (NEB, MA). hTERT-RPE1 cells were then transfected with this vector by electroporation, using NeonTM Transfection System (Thermo Fisher, MA), along with vector pCD2E (a kind gift of K. Caldecott, Univ.

Agarose Gel Electrophoresis:

Gel Extraction:

Polymerase Chain Reaction:

Article Title: An anhydrobiotic cell line expressing odorant receptors shows odorant responses after dry storage
Article Snippet: .. The vector was treated with the restriction enzyme BbsI (New England Biolabs) and PCR product inserts corresponding to P2A-GCaMP6f and P2A-Orco were assembled using NEBuilder HiFi Assembly kit (New England Biolabs), generating the donor vector pCR4-Pv.00443#1μH-P2A-GCaMP6f-P2A-Orco (Supplementary data 15). ..

Article Title: An anhydrobiotic cell line expressing odorant receptors shows odorant responses after dry storage.
Article Snippet: .. The vector was treated with the restriction enzyme BbsI (New England Biolabs) and PCR product inserts corresponding to P2A-GCaMP6f and P2A-Orco were assembled using NEBuilder HiFi Assembly kit (New England Biolabs), generating the donor vector pCR4-Pv.00443#1μH-P2A-GCaMP6f-P2A-Orco (Supplementary data 15). ..

Control:

Ligation:

other:

Article Title: Hypoimmunogenic hPSC-derived cardiac organoids for immune evasion and heart repair
Article Snippet: To generate the knockin cells, B2M KO cells were dissociated with Accutase (STEMCELL Technologies) for 10 minutes at 37C and pelleted.

Review